Corrigendum: Crawling Motility on the Host Tissue Surfaces Is Associated With the Pathogenicity of the Zoonotic Spirochete Leptospira (Frontiers in Microbiology, (2020), 11, (1886), 10.3389/fmicb.2020.01886)

Jun Xu; Nobuo Koizumi; Shuichi Nakamura

doi:10.3389/fmicb.2021.736406

Corrigendum: Crawling Motility on the Host Tissue Surfaces Is Associated With the Pathogenicity of the Zoonotic Spirochete Leptospira (Frontiers in Microbiology, (2020), 11, (1886), 10.3389/fmicb.2020.01886)

Jun Xu, Nobuo Koizumi, Shuichi Nakamura

ENG - Applied Physics

Research output: Contribution to journal › Comment/debate

Abstract

In the original article, there was a mistake in Supplementary Table S1 as published. In the original version, “TATCGATACCGTCGATCACTTGTACAGCTCATCCATG” was shown as the reverse primer of AcGFP, but “GCTGGCCGGCGTCGATCACTTGTACAGCTCA TCCATG” is correct. The corrected Supplementary Table S1 appears below. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated. (Table presented.).

Original language	English
Article number	736406
Journal	Frontiers in Microbiology
Volume	12
DOIs	https://doi.org/10.3389/fmicb.2021.736406
Publication status	Published - 2021 Aug 17

Keywords

bacterial motility
biophysics
host–pathogen association
leptospirosis
optical microscopy
pathogenicity
spirochete
zoonosis

Access to Document

10.3389/fmicb.2021.736406

Fingerprint

Dive into the research topics of 'Corrigendum: Crawling Motility on the Host Tissue Surfaces Is Associated With the Pathogenicity of the Zoonotic Spirochete Leptospira (Frontiers in Microbiology, (2020), 11, (1886), 10.3389/fmicb.2020.01886)'. Together they form a unique fingerprint.

Cite this

@article{73daaa8771084a3d9f428603dfa842bf,

title = "Corrigendum: Crawling Motility on the Host Tissue Surfaces Is Associated With the Pathogenicity of the Zoonotic Spirochete Leptospira (Frontiers in Microbiology, (2020), 11, (1886), 10.3389/fmicb.2020.01886)",

abstract = "In the original article, there was a mistake in Supplementary Table S1 as published. In the original version, “TATCGATACCGTCGATCACTTGTACAGCTCATCCATG” was shown as the reverse primer of AcGFP, but “GCTGGCCGGCGTCGATCACTTGTACAGCTCA TCCATG” is correct. The corrected Supplementary Table S1 appears below. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated. (Table presented.).",

keywords = "bacterial motility, biophysics, host–pathogen association, leptospirosis, optical microscopy, pathogenicity, spirochete, zoonosis",

author = "Jun Xu and Nobuo Koizumi and Shuichi Nakamura",

note = "Publisher Copyright: {\textcopyright} 2021 Xu, Koizumi and Nakamura",

year = "2021",

month = aug,

day = "17",

doi = "10.3389/fmicb.2021.736406",

language = "English",

volume = "12",

journal = "Frontiers in Microbiology",

issn = "1664-302X",

publisher = "Frontiers Media S.A.",

}

Corrigendum: Crawling Motility on the Host Tissue Surfaces Is Associated With the Pathogenicity of the Zoonotic Spirochete Leptospira (Frontiers in Microbiology, (2020), 11, (1886), 10.3389/fmicb.2020.01886). / Xu, Jun; Koizumi, Nobuo; Nakamura, Shuichi.
In: Frontiers in Microbiology, Vol. 12, 736406, 17.08.2021.

Research output: Contribution to journal › Comment/debate

TY - JOUR

T1 - Corrigendum

T2 - Crawling Motility on the Host Tissue Surfaces Is Associated With the Pathogenicity of the Zoonotic Spirochete Leptospira (Frontiers in Microbiology, (2020), 11, (1886), 10.3389/fmicb.2020.01886)

AU - Xu, Jun

AU - Koizumi, Nobuo

AU - Nakamura, Shuichi

PY - 2021/8/17

Y1 - 2021/8/17

N2 - In the original article, there was a mistake in Supplementary Table S1 as published. In the original version, “TATCGATACCGTCGATCACTTGTACAGCTCATCCATG” was shown as the reverse primer of AcGFP, but “GCTGGCCGGCGTCGATCACTTGTACAGCTCA TCCATG” is correct. The corrected Supplementary Table S1 appears below. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated. (Table presented.).

AB - In the original article, there was a mistake in Supplementary Table S1 as published. In the original version, “TATCGATACCGTCGATCACTTGTACAGCTCATCCATG” was shown as the reverse primer of AcGFP, but “GCTGGCCGGCGTCGATCACTTGTACAGCTCA TCCATG” is correct. The corrected Supplementary Table S1 appears below. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated. (Table presented.).

KW - bacterial motility

KW - biophysics

KW - host–pathogen association

KW - leptospirosis

KW - optical microscopy

KW - pathogenicity

KW - spirochete

KW - zoonosis

UR - http://www.scopus.com/inward/record.url?scp=85114443215&partnerID=8YFLogxK

UR - http://www.scopus.com/inward/citedby.url?scp=85114443215&partnerID=8YFLogxK

U2 - 10.3389/fmicb.2021.736406

DO - 10.3389/fmicb.2021.736406

M3 - Comment/debate

AN - SCOPUS:85114443215

SN - 1664-302X

VL - 12

JO - Frontiers in Microbiology

JF - Frontiers in Microbiology

M1 - 736406

ER -

Corrigendum: Crawling Motility on the Host Tissue Surfaces Is Associated With the Pathogenicity of the Zoonotic Spirochete Leptospira (Frontiers in Microbiology, (2020), 11, (1886), 10.3389/fmicb.2020.01886)

Abstract

Keywords

Access to Document

Other files and links

Fingerprint

Cite this